Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E058F06
Clone ID E058F06
Vector rFROSAbgeo0s
Project ggtc

SPLK-Sequence tag 3SE058F06
Sequence
GGTGCAGCCCCAGGAATTTGATGCAGTTTTAGGAG
Sequence Type genomic DNA
Unitrap ID UNI29765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 65756570..65756604 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072511 (Hhla1) HERV-H LTR-associating 1 Gene [Source:MGI Symbol;Acc:MGI:3615329]

 
Come back to gene ENSMUSG00000072511


For any suggestions or comments, please send an email to unitrap@crg.es