Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E057H05
Clone ID E057H05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE057H05
Sequence
TTTTATCTGAGTCTAAAATTATGATGAGTTTCTCTATGTGGTGCATACAGCTATGTTTATGTGGAAATTGCTGGAAAGCT
TTCTTTTTTCCTTCCTGGTAATTCTATGTTCTTCTTCTGTGAGAATCTATCTGCTCTTGGCCCTCTCAGCGCTGCATTGT
CTGAGTGATCTCATTCCTGCCCACGCCTCAGTCACTACCTGAGACATCCATTACAAGAGTCAGCTTCGTCTTTCTCCCTT
AACATCTGTCCCTTTATCTCTGGTCCTCGCTTCTCTTAGTGACTCCATAACCCGCATGAGAAGAAAAGCAAGAATCTAGG
GTTGTTTGTAACTTGTCACCCTGGTTGTGTATATGCTCATTTAGTTCCATTGACTGTACATCAGGAGTTTTCTCTAGGCC
CAATAACACTAGGAAGGCCTTTAGAACTGGGCATCAGTCTCTTTTCAGCGGCCTTACACTGACTGGCTTCATGTTTCTGC
CTCTTCAGATGACTTTTCATACTGATTTTTAAATTGAAATAAGTCCATTTCTTAATACAGTGTGAAACTTGCAATTCTGG
AATTGCAAATCTGGAATCTAAAGATTAAGCTCCTTANNNNAGTAGGGGAGATCC
Sequence Type genomic DNA
Unitrap ID UNI29821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 146430702..146431315 600
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005034 (Prkacb) NM_011100 protein kinase, cAMP dependent, catalytic, beta Gene [Source:MGI (curated);Acc:Prkacb-001]

 
Come back to gene ENSMUSG00000005034


For any suggestions or comments, please send an email to unitrap@crg.es