Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E057G09
Clone ID E057G09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE057G09
Sequence
ACTTATGAGCCCTATCTTCAGATAGATCAATTGACTCTTCCTGCTGTGGAATTGCTTAGAACTTCTGTAGCATATCTGGG
GTCCCTTGATGCACCCATCAAGGGAAAAGCAGCCCAGGGGTTTGAGCTATCTCAAGCTGTTTAGAAAGCTCCTGCCTGGG
AATTGTGTGCCGTTTGAGGCCTGAAGCTTGCTGG
Sequence Type genomic DNA
Unitrap ID UNI29823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109418716..109418909 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041438 (Cirh1a) NP_035704 cirrhosis, autosomal recessive 1A (human) Gene [Source:MGI Symbol;Acc:MGI:1096573]

 
Come back to gene ENSMUSG00000041438


For any suggestions or comments, please send an email to unitrap@crg.es