Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E057G07
Clone ID E057G07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE057G07
Sequence
GATCCCCCAANNNNTCCCGGCTCTCCTGCCGCCATGGCTGACAAGGAAGGTGAGTGTGCCGAGGCCGGCTCGGAAGGGAC
GG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE057G07
Sequence
CGCTAACTTGATTTGTCTTTTAAAAANNGTTTTAGCGGCCTTTGACGACGCATTGGAAGAACGGGTGATCAACGAGGAGT
ACAAAATATGGAAGAAGAACACCCCTTTTCTTTATGATTTGGTGATGACCCATGCCCTGGAGTGGCCCAGCNNNNACTGC
CCAGTGGCTTCCAGATGTGACCAGGTGACGCGAATCTTGAATATTTTTGGTAGTTCATATATTTTAATTTTTTTGCCCTC
CAGTCACTCAGGGGGGACATTATCAGAGCTTATGAGTACTATTTATTTTCCTCGACTAGAAATAATGTCAAAAACAGAAG
ATCATTTTGTAATTTACCCTGCAAAGAAAACATGCTCTGTTGTTGTGTTGTTGTTTGA
Sequence Type genomic DNA
Unitrap ID UNI10890

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 129011547..129011922 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057236 (Rbbp4) NM_009030 retinoblastoma binding protein 4 Gene [Source:MGI (curated);Acc:Rbbp4-001]

 
Come back to gene ENSMUSG00000057236


For any suggestions or comments, please send an email to unitrap@crg.es