Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E057G04
Clone ID E057G04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE057G04
Sequence
CGAGATCAGGACTTCAAGGGGCCTGTGCTGAGGCCAAAGCTCAGCCAATAGAGACTCAGACCCAGATTGGGAAGCCAATC
TTGTCATTGTCACCAGCACTGCCCTGACACTCCTTATCTTGGTGAAGGGGGCAGTGCCCCCCTCCTCAGAGACAGCCTCT
CGGGTTCTTNNAGG
Sequence Type genomic DNA
Unitrap ID UNI29824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 43634361..43634534 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050541 (Adra1b) NM_007416 adrenergic receptor, alpha 1b Gene [Source:MGI (curated);Acc:Adra1b-001]

 
Come back to gene ENSMUSG00000050541


For any suggestions or comments, please send an email to unitrap@crg.es