Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XA153
Clone ID XA153
Vector pGT0pfs
Project baygenomics

Sequence tag XA153
Sequence
CCTCTTCCTCCGTCGGGCCCCGGGCCTCTGCGCAGACAACATGGAGGCCGTGAAGACCTTCAACAGCG
Sequence Type mRNA
Unitrap ID UNI1267

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3115349..3115416 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]

 
Come back to gene ENSMUSG00000046201


For any suggestions or comments, please send an email to unitrap@crg.es