Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E055G07
Clone ID E055G07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE055G07
Sequence
TTACTCGAAAGTTCTCTAGGGAAGCCCCTTTGCCCAGGATTTTGGCATTTTTGTACATCAAGTCAAACTCTGGTATTCCT
TAACCTCTTTGACAAAGCTTCATTTTTCTTGCCTATGAAATGTGTTGTTAGAAATATTT
Sequence Type genomic DNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17244667..17244805 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es