Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E055E11
Clone ID E055E11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE055E11
Sequence
GATTTGGGGCGCGCATACAAGCGCCTCCGGGTTTGGGGACCCCGATTATTTTTTATCGCTCCCCTGTCCTTGCTTTCGCG
TTTATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE055E11
Sequence
ATCATCTGGAGTCCAAGGNNNTCATCAGAGGGACTTGGCTTGGCAGGACGACGTCCCAGTGCGATGAGAGTCCGTCTTCT
GCATTTTCCTACCCCCTCCACCCTCCCCTCAAAGCCATCCATCCTCCAGCGTTCTTTCCCCCTTGAACGTGCATCCGCAC
ACGGACCCCAGTCCGGGTGACAGTGTGGCTCTCTCTGATCATCAGATTGTTGTGTCCCTGAGGACAGGGGGACGCTGCCG
CGTTCAGCGAGCACCCGCCAGGTAGGTGCTGTGTTGTTATTATCCTGGAAGTGGGTTTCGCAAGAGAAACTCCCAAGACC
TCGCTGGACCAAGAATTAACAGTTAAAAGTCAGGTTTCAAACCCCGGGGTAGCTAGGAACCTAGAGAGAACCTGCCGCCT
TCCAACTGTTCACCCTGTGGGAACCCAGGATGTCCAGTGGTTGAGGAGAGGTTCAAAAACAAAAACCCAGCTTTCCTTTT
GTCCGACTNNNGGGTTTCTGCCGTGTGGTTTCCTACTTTGGAGATTTCAAATTTGACATAGGTCTGG
Sequence Type genomic DNA
Unitrap ID UNI134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122608799..122609343 525
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]

 
Come back to gene ENSMUSG00000004455


For any suggestions or comments, please send an email to unitrap@crg.es