Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E055A08
Clone ID E055A08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE055A08
Sequence
GTCTCGTATCCACTCTTTCTTCCCACATTTACTGCTGTCATCCCATAGCAATTGCTTGTCTCACAATATCTCTCCAGTTC
CTCTCTTGTCATTTTCCTGCTATCTGCAGGGAAATCTGAAGTATCTCTTAGAAACAGGAAGATTCCTGGGTTAGTAACCT
TTTAAGGCATTACTGAACAGAGTAACACACACAAAGACCTTTCATTGGTTCTGGCATCTCAGGACACACTCCTAGAGGAC
CTGGCCTATCTTTTCTGCAAGCCATAGATTCCCCTAAGTCAGTCCATGGAACCTCTTAACCCCACTCCCTGCCTTGTTTT
CTCAAGTGCCAGCCTAGGGAAAAAACTCTCTTTCATTCTCTTTCTTATGCAAGGAAGCTAACAGTGGGTGGGGCTCTTGA
TGCCCCTAGTAAGGCTCAAGCCTGCCTGCTATCCCCCAAAGCCTGCTCCACTTTGAAAGAGACGGTACTAGAAAAAAAGA
TTGTGCCATTCTGGCCTGAAAAGAGGTTAGAAAAGGAAGAG
Sequence Type genomic DNA
Unitrap ID UNI10238

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12744590..12745114 481
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]

 
Come back to gene ENSMUSG00000021745


For any suggestions or comments, please send an email to unitrap@crg.es