Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E055A03
Clone ID E055A03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE055A03
Sequence
ATTTAACGTGTTTAGCGTATGGTCTTTTGTGAAGTCACACTACCATCATAGTACATAGTTTAGTACTATAGGGCTTTGCT
GTGTTAACAGCTATTAACACGGTTAATCTGTACTGATTAGTAACCTGTAATAGAAACACTGGTTGGTGTGAATTGCCCCA
ATTGTATGTGTTCGAGAAATACACAGACTCTGAGAAACTCTTGGATGGAATTTAATTTTTAATAAAAAGAATGCTCTGTT
CAAAGCCTGAAGGTGGTTTTGACAGTGCATGCTGAGCAGG
Sequence Type genomic DNA
Unitrap ID UNI2225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 93961177..93961455 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042167 (Papd4) NM_133905 PAP associated domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2140950]

 
Come back to gene ENSMUSG00000042167


For any suggestions or comments, please send an email to unitrap@crg.es