Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E054F12
Clone ID E054F12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE054F12
Sequence
GATCCGGTGGCGGACACAAAGGGGCCGAGCCGGGCTCTGGACTCGGGGGGGTTTTGTTTAGTCACATGTAGCGGAGCAGC
CAGTGAGCGGTAGGGGGAAGGGGGCCGAGA
Sequence Type genomic DNA
Unitrap ID UNI29830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107125062..107125170 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049606 (Zfp644) NM_026856 zinc finger protein 644 Gene [Source:MGI (curated);Acc:Zfp644-001]


SPLK-Sequence tag 3SE054F12
Sequence
TGGGACCAGAGCGCATAGCCTTCCCCTTCTTCCCACTGGTCTGCAACATCTTGTGCCGCTAAGTGCCTGAGAAGTAACTC
CAAGAGGT
Sequence Type genomic DNA
Unitrap ID UNI29830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107124815..107124902 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049606 (Zfp644) NM_026856 zinc finger protein 644 Gene [Source:MGI (curated);Acc:Zfp644-001]

 
Come back to gene ENSMUSG00000049606


For any suggestions or comments, please send an email to unitrap@crg.es