Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E053E12
Clone ID E053E12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE053E12
Sequence
GATCTGAGTGTGTGAAATGTAGTGGTTGGGGAATAGGTGCTGATGAACTGCCCCAAGAGGGCTGTGTATGTGCGCTTGCG
CAAGGCACTTCACACAGTATCTGCCTGT
Sequence Type genomic DNA
Unitrap ID UNI17422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109119756..109119859 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]


SPLK-Sequence tag 3SE053E12
Sequence
CCTGTAGGCCGCAGTCTAGTTCATGATTGCAACTTTTCTGCTAACATTTTTCCGATCATGACCTTACGAATATGGGGGAA
AGGACTAGGTGTCAGTACTGTTAGCTCTGATTAAGCCCGGCAATGTGAAAATAGACTGACCTCAACAGAAGCAGATTGTC
CTTTAATTAGAACAATGAAGGGCAGCAGGCTCTCTGGGGAGTGGAGGCTGAAGAGATACAAAGGGCTTGGGGTTTTATAG
GGCAGAAAAGGGAACTTTTGAAGGTTGGCGATTGCATCTGCAG
Sequence Type genomic DNA
Unitrap ID UNI17422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109119855..109120137 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]

 
Come back to gene ENSMUSG00000066306


For any suggestions or comments, please send an email to unitrap@crg.es