Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E052B05
Clone ID E052B05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE052B05
Sequence
CTCATAACTGACACCGTGTTCTCTGCCATGCCATTCTCCTTCAGACCTCTGCACTTTGCAGGGTTATTCCATTTGAAGTC
ATTTCTTCTTGCCTGAAAAAGTGCTCATCCTTCAGACTCAGCCTGAACGGTACCTTTATGTGACACGGTCTCTGAGACAG
TCCCTGGGCAGCCATGGCATAGGTATGGCTCTTAGAGCAGTGTATGGAGAGGAGGCCTGACTTGGTCATCATACCGCGTG
CTCCCAGAAGCTGGGACTTTTAAAGCCCACAGCAACTCCGGCATTTAGATGGCCTAGGGCATGCCACATGCCCCTTGTTC
TGTGACTGAATGAAGAGGATGCCCTTTCTTCTCTTTTAGATTCTAGACCCAGGCTTCCTCAGCCCCCAGAAAGCCACCAG
ACCTCACATGGAACCAAAGGCCCCATGCCCAGCCGCCGTCCCCTCAGAGGAGAGGAAGTTCCGTGTTCTTGTGGGCGTCA
CTGGCAGCGTGGCCGCTCTGAAGCTGCCTCTCCTGGTATCTAAGCTGTTGGACGTTCCTGGGGTGAGTATCTTCTCAAGA
TGAGTGCAGTGGCTTCTGGCACTAAGGAGTCCTGCGTCTGCAGGGCATGGGATTTTCTTTCCCCTTAATCCTGGTCTGTA
TAGAAGGAGATCC
Sequence Type genomic DNA
Unitrap ID UNI10480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57282599..57283251 653
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063849 (Ppcdc) NM_176831 phosphopantothenoylcysteine decarboxylase Gene [Source:MGI Symbol;Acc:MGI:1914062]

 
Come back to gene ENSMUSG00000063849


For any suggestions or comments, please send an email to unitrap@crg.es