Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E051H08
Clone ID E051H08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE051H08
Sequence
CTTCAGTAATATCTAGTCTATTAATGAACCCATCACAGATTTAATTTTTTGTTACATTTGTGTCTGTGTATATACACCAT
GGCATCTAGTTTATAAAGGTTTTTGTCCT
Sequence Type genomic DNA
Unitrap ID UNI29837

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59549891..59549999 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028382 (Rod1) NM_144904 ROD1 regulator of differentiation 1 (S. pombe) Gene [Source:MGI (curated);Acc:Rod1-001]

 
Come back to gene ENSMUSG00000028382


For any suggestions or comments, please send an email to unitrap@crg.es