Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E051G08
Clone ID E051G08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE051G08
Sequence
ACTATGTACTGCAGTTCCTGGTTGACTCACATTATCTCCCTGCTGCCCTTAGCACTGAACTTAGAGCTTCTTGACTGGAG
GGTCAT
Sequence Type genomic DNA
Unitrap ID UNI14461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21858248..21858333 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]


SPLK-Sequence tag 3SE051G08
Sequence
TCTTGTTCGTCTTTGCTAATCTTTCTTAGTTTGAAAAGTGTCCAGAACATAGTCTTTATTCTGTGAGTCATGGCATTTC
Sequence Type genomic DNA
Unitrap ID UNI14461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21858699..21858777 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024754 (Tmem2) NM_001033759 transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1890373]

 
Come back to gene ENSMUSG00000024754


For any suggestions or comments, please send an email to unitrap@crg.es