Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E051E12
Clone ID E051E12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE051E12
Sequence
GGCATGTCCCACCATGTCCAGTTGCATAATCTTTTTCTTTTTTTCTTGGCTTTTATAGAAGCTATAAACATTCAGAATTC
AGGGAAGCACAGTCTTTACAGTTGGGGGACGAGGAAAGTAAGTGAGAGGAAAGGTAGCCTCTGTACTTCCTGGTGAGTTT
ATTAAGGAAAGTGAACCAGACTTCGTGGACTTGACCTTAAGCCTCTGTTAGAGGAAGTTTGTGACTGCGTTTAAAGATCG
TTAATGTTTAAACACCGACTCAAAGGTGTCTGATTTAAGTGTTCACTTCCGTCTTCTATCTGGAAAGCAGTTATGGAAGA
TAGCCATATCAGTAAAACTGTGTTTACAGGAAAGGCCAACTGTGGGCTGTGGACCGCAGTTTGCTGATCTCTGACTCAGG
GGCAGCTTGAGACCGGGCACAATGTTTTTAAACTCATAAGCAAAG
Sequence Type genomic DNA
Unitrap ID UNI19627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59770103..59770544 431
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021556 (Golm1) NM_001035122 golgi membrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917329]


SPLK-Sequence tag 3SE051E12
Sequence
AAGCGGAGGCCTCGGTCCTCGCAGACCTGGGTGCTGNNNCGGGTTGCTTATCCCCGTGTGTTTTGACCATGTCTGCTTTC
CCGCCAGCTGGCTGGGTTTAGGTGGAGCCCATCCTGTGGGTAGGACAGAGGTGTGGCCTGTTTGGTAACTTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021556


For any suggestions or comments, please send an email to unitrap@crg.es