Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E051D11
Clone ID E051D11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE051D11
Sequence
GCTTGTGGCACAAGTGTGGAGATTTGAAGTCTTCTATACATAGAATGACAACCCGGGATTTGATTCCTGGGTGCTTCCTT
TACGGCCCTTCAAGAAGGCTGACAAGTGATGGGAAAACGGAGGCCGAATGTGTAAACGCTGCGACTTCCAAAAGCGTTTT
AGAGAGATNNNNGTGTGTTTGCCGCTTCCCAGCCTCTCTCTTCGGCTAAAAGATGAGTGCAGCGATATTATGTGGGTTGG
CTTTCTGGGTTGGGGTATAGGCTGGGGTCCCCGGGAGGCAGTAACTCACTGGAATTCTTTTGTTTGTTTGTT
Sequence Type genomic DNA
Unitrap ID UNI29838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108484839..108485148 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017765 (Slc12a4) NM_009195 solute carrier family 12, member 4 Gene [Source:MGI (curated);Acc:Slc12a4-001]


SPLK-Sequence tag 3SE051D11
Sequence
TTCAGGTGTGGTCGTCNNNNNTGGGGCTTCTCCGGACCTCTCAGCTAAGCATCAGGCTGGCTTCTCTTCCACTCCCAACT
GCCCTCTCTTTGCAGCCATCCAGGCTATGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017765


For any suggestions or comments, please send an email to unitrap@crg.es