Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E051A12
Clone ID E051A12
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE051A12
Sequence
CTGGATGGGAATAGATTGTTGGGTAGAGAGTGGGCGGAGAAAAAGTGTGCCCGGGCTTTTTTTCAGGGTAAATTTCACTG
GCTTGCCTGTTGCTGTG
Sequence Type genomic DNA
Unitrap ID UNI4851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40507187..40507283 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042032 (Mat2b) NM_134017 methionine adenosyltransferase II, beta Gene [Source:MGI (curated);Acc:Mat2b-001]


SPLK-Sequence tag 3SE051A12
Sequence
CTGTGCTTCGGAGCTTGTAACCTGCAGGTTACAGTTGAGAGCTGAGTCAGACCCTGCGAGCTGTTGTTTCTGATTAACTT
TTGAACAACCACACAGGGCTGGAAGGAGCGCCTGGCATTCCGCCCTTCCTTGGCTCCCTCATTTTAAGTCTTAGCAGCTC
CTCCTTGGCTTGGCTCCAGCAGCCCCGGGCG
Sequence Type genomic DNA
Unitrap ID UNI4851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40507001..40507191 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042032 (Mat2b) NM_134017 methionine adenosyltransferase II, beta Gene [Source:MGI (curated);Acc:Mat2b-001]

 
Come back to gene ENSMUSG00000042032


For any suggestions or comments, please send an email to unitrap@crg.es