Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E049F10
Clone ID E049F10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE049F10
Sequence
GTCTAAATGTAACAAATGCTGCAGTTCCTAGTGTGTGTGAGCTAACCTGTGACTGGCAAGAGCTTTAGCGGATATGCCAC
ATGACCCTTCAGCCCTGAATTCATTCGGAATAAACCTTTTAGAGCAAAAAGGGACAGTGGGTGGGACAGTGGGTGGGGCA
GGTGGGACTTTCCTTCAACAGTTCTGCACTTTACCCGAGGCCTTCATGGCAG
Sequence Type genomic DNA
Unitrap ID UNI4541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77957407..77957618 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037750 (BC017647) NM_145430 Uncharacterized protein C17orf63 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6P539]


SPLK-Sequence tag 3SE049F10
Sequence
AAAGCACACTACAGCTACACTTAGCAAGCAGCTCATGAATAGTTTGCTGTGAGACTTCAACAGTTAAAAATAGTCTAGTC
TTATA
Sequence Type genomic DNA
Unitrap ID UNI4541

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77957780..77957864 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037750 (BC017647) NM_145430 Uncharacterized protein C17orf63 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6P539]

 
Come back to gene ENSMUSG00000037750


For any suggestions or comments, please send an email to unitrap@crg.es