Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E048F06
Clone ID E048F06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE048F06
Sequence
GATCTAAAGGAACCAAGTGGGATGAGTGCAGGCCTTCTCCAGCCTTCTGTCACATTCCTGTCTCCAGCGTCAGGCCAGAG
ACCTGCGTGACAAGCAGGATTCTTCTCTGCCTTCCTCCTGCAGTGTGGATGTACACTGACAACTCTTAAAGGTCAAGGGG
ATGGGCCTGGGCTGCCAGACTCCACCTCAGCCCTGAGTACACACACTTGTAGCCGCAAGAGCCC
Sequence Type genomic DNA
Unitrap ID UNI19990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46265080..46265303 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023967 (Mrps18a) NM_026768 mitochondrial ribosomal protein S18A Gene [Source:MGI Symbol;Acc:MGI:1915815]


SPLK-Sequence tag 3SE048F06
Sequence
GCCCAGCCCATCTGTTTAAAAACAACAGTCCCCTCCCCCAAAAATGCTTATGCCTTTTGAGAAAGGAAAACTGGTGAGGG
AGGCAGCACAGCCCCAGGGGGCAGTGTCCGGCTCTTCCTGCCCCAGCAGGCAACCTCTTGTGTTCCCACTACAGCTATCT
GACTCGCTGGGCTCCCAAGTCCGTCAAGCCCATCTATAAAAAAGGCCACCGTTGGAACAAGGTGGGTATGGCCGTGGGGT
CACCACTCCTGAAAGACAATGTCTGCTACTCCAGAAGGCCTCTGAAGATGATGCATTAGTGGGAGCAGGACTTCTGAAGA
GCTGACTAGAACCGTCTAGAAGATGCACTTGCTCCTCCCACCAGAACCATTATCCTCCACAACAGCACAGAGAACTAACT
TCTGTGCCTTGG
Sequence Type genomic DNA
Unitrap ID UNI19990

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46265300..46265711 403
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023967 (Mrps18a) NM_026768 mitochondrial ribosomal protein S18A Gene [Source:MGI Symbol;Acc:MGI:1915815]

 
Come back to gene ENSMUSG00000023967


For any suggestions or comments, please send an email to unitrap@crg.es