Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E048F03
Clone ID E048F03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE048F03
Sequence
GATCTCTGAGTTTGAGGAGAGCCTGGACTACAGAATCGAATCCAGAACAGCCAGGGCTCCACAGAGAAAAACCCTG
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857981..97858054 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


SPLK-Sequence tag 3SE048F03
Sequence
GGCCAAAATTCCCCAGCTTAACATTTAATTTATGAATTAATTTGGACAATTTTTACACTTCAGGCCCCATTCTATGTCTG
GCTTTGGATAAACTACTTGGCTTACGGCCCCTTTAAGCTTTCCCAGCCAGGTAGAATCTGTTAGGGCCTTACATGGCCAG
AGCCCAAGGTCCTTGACAGGATTTGACCTGCCTGCTTTAGAGTTTTTTAACCGAACAGACGCTTAAAACCAGGAGGGAGA
ATCAAGGGGTTTACCATAGCTTCCTCCCCCCCCAAAACCTCTAACCTTCCTCATTTTTGTAAGGGGGGGCCAGACCCGTT
ATAATGCCAGCAGTTTATGTGCCCCTAATTCATCCACTAAGATTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es