Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E048E08
Clone ID E048E08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE048E08
Sequence
TAAGGGTTCCCCAGCTCGGAATTAGCTATTTGTTATCACTTTAGTAAATAGATGTCTTGTGCAGAACTTTTGCAGGAAGA
ATCTCACAGAGATTACTT
Sequence Type genomic DNA
Unitrap ID UNI14321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33412427..33412524 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040594 (Ranbp17) NM_023146 RAN binding protein 17 Gene [Source:MGI (curated);Acc:Ranbp17-001]


SPLK-Sequence tag 3SE048E08
Sequence
AGATATTNNGATGTTCATAGTGCAGGTGTAAGTCTTGAGTAAATCAGAAGGCGTACAAGAACTTTGGAACCTTTTTGGAC
TTAGACGATGCCTGGTA
Sequence Type genomic DNA
Unitrap ID UNI14321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33412314..33412410 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040594 (Ranbp17) NM_023146 RAN binding protein 17 Gene [Source:MGI (curated);Acc:Ranbp17-001]

 
Come back to gene ENSMUSG00000040594


For any suggestions or comments, please send an email to unitrap@crg.es