Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E048E06
Clone ID E048E06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE048E06
Sequence
ACACGGGAATGGAAAAACCATCTGTGTGGAACTGAACGGCTTTAAGAATAGCTGTGTTTGAGAATAGATTGTTAGAGTCT
CCCCACAGTACCAAGAAAAATTTAAAAGCTCATGAGAAAAACTGATTTCCAAACAGTTTCAAAGCCTCTCGCCATTTCTT
GGATCACAAAGGGCCTTAGGAGATCGGTGTTGACGTTTTGGGTTCACTCTCTGTCGGCGTTGTCTCAGAGCTGTCTCTGT
AGCAGATGGACCTGCCTGCGACACAGCTGACCTGTTCACTTCCTCTGTTTCTGCTGTTAGAAACCTTCATTG
Sequence Type genomic DNA
Unitrap ID UNI17846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121538654..121538963 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]


SPLK-Sequence tag 3SE048E06
Sequence
ATTGGCGATATGGCAGCTCATGTCCGCAACAAAATGGTCAAAATTAATGGATTTTAAAATGGCCTTATAAGCCATTTATT
TATGACCCTAACAATTGGACAGAATGTCAGTTTAGTGTTTCATGTGGTTAGAGGATATCAATCAGCTTCCGGGGTAATTT
TTAAATACAGGCCACTAATTCTTTTTATGAATGCTCTGAGTCTCTAAGCACATTCGATCATGAG
Sequence Type genomic DNA
Unitrap ID UNI17846

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121538434..121538657 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]

 
Come back to gene ENSMUSG00000027238


For any suggestions or comments, please send an email to unitrap@crg.es