Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E046D10
Clone ID E046D10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE046D10
Sequence
TATCTGTAGGGCATCAGATTTACAATCCCATATAGGGAAGTAATTTCAAAAGAGCGTGCNATTTTATAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE046D10
Sequence
TCTTTCAATAAGTAAATCAACAATACTAGCTATTATTTATGTTTGCTTCATGTCAGGAATAGTGCCATATGCTCTGTGTG
GAAGGACTTCCTGAGTCCTCTCAGTTGCTCTGCATGCTGACTCTGAGTCATTCTTCCTGTAACGTTGCCTGGGTGCAGCC
CCAGGAATTTGATGCAGTTTTAGGAG
Sequence Type genomic DNA
Unitrap ID UNI29765

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 65756570..65756755 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072511 (Hhla1) HERV-H LTR-associating 1 Gene [Source:MGI Symbol;Acc:MGI:3615329]

 
Come back to gene ENSMUSG00000072511


For any suggestions or comments, please send an email to unitrap@crg.es