Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E046A09
Clone ID E046A09
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE046A09
Sequence
CTGCAGGTGGGTGTGAGATCACAGTGGCGTGGCGTGGGCTGGTGATGTNNTATCAACCAGACGTGCNCTGCATTGGAATG
TGAAGAGTTAACAAGCTGACTAACCTAGTCTCTGCAGGGTAGCTCTAAACATTTGTTAGACTCGATAGATTTTTCTTACT
TCATCCAAAGAGGGCATCTAGTTAGATACATTACACAATGCCCAGAGTTAAGAGGTAGAATAGAAGGTGTCCATAGCTTC
AGTACAGACTAAACTGGGGTGCCCTAGAGAAGAGCCCCAGCCTGGTTACTGCCATGGACGGTCTTTGAGGTGTTCATTCT
GCAGACATGGCCGCTGCCCATGGCTTCCACTGTAACAGCTCATCAATGGGGAAAAAGTCCCTGACAGGGATGGTGTGTGT
ATGTATGTGTGGACACAGAAAGTTTTTCATGAACTTCAGGCAAATTCTAAAACTATATGTCTAAAAGCCATGTAATCTTT
GAGTAGAAAATACTCCTTCCATAGCTTGGAAAGTGTGGTCTGGAAGGACACCCTAAGGTGCACTCTCAGACTCAGTCTGC
TTGGTATCTAGGTCACTGATGTCTTCTGGTGTGGCGTGACTTCCAATAGGAGAGGCTTTTGGCTGTACTTACTGCCCCGG
CCGCTCAGCTATCAGGAGTGCTCCGTTGCAGGAGTTGCAGGGAGTGTGGCGCCTATAGG
Sequence Type genomic DNA
Unitrap ID UNI22778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42267898..42268596 683
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]


SPLK-Sequence tag 3SE046A09
Sequence
AGGATCGTCTGCTTACTTTCAAATAGAAGGTTTTAAAAATTCAGATCAGATAATGTAGTTTTTAAAACCAATAAGGTGAT
TAACTGACTCTCATCTTTAGACTCTTAAGGTCTTTTCTGGAAAAGACATATATAACATATCCATACACTGTCCTAGAGTG
ATTGTGTTTCAGTGGGATGCACTCGTGCTATGGATCAGAACCACTTTTCAGAAAATGAATCAAGGGAAAACCTGAAACTT
CCTAGAATACAATGTTGAAGGTTTGGGATCAAAAACAGAAAGGAGTTTTGGGATGAGGTTAAAAGAGGAATCCACACTTA
GTGAAAGTCAAATAGATGAGGAAGGACTCGAACATTAAGAGAGCTGGTAACCCCAGGGGATTGTGGGAAGTGGCCCAGGA
GAGTGTCTCCTTTAGGCTTTGCTTTGCTACTTACTGCTGGCCTTTGCAGACTCCTCCCACTTAGCCAGCAGGGTTCTCTC
TGACCCTAAGCAGCAGCAGCAGTCCTTGACCTCTGGGTGTTCTTCATCAGCCACTCCTCTCTGGCACTTTCATTCCAGCC
CCGCTAAGGTCAGGCTCATACTCTGTCTCTGCCTACGTTTCATTTCCTTATGGCATGCTTCAACTCCCTCCCTTGTCTAT
GGTGAAACTACTGATGCTTTCCCTGACGTGAGCAAATTCAGGTTGCCCCACCCTGGAAGGACC
Sequence Type genomic DNA
Unitrap ID UNI22778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42267198..42267900 703
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]

 
Come back to gene ENSMUSG00000037287


For any suggestions or comments, please send an email to unitrap@crg.es