Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E046A06
Clone ID E046A06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE046A06
Sequence
GTGTGTGTGTACATGATCATGTGTGTGGGATAAGTGTGTTAAGGTCAGAGGTCAACCT
Sequence Type genomic DNA
Unitrap ID UNI9646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 168051735..168051792 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026564 (Dusp27) NM_001033344 dual specificity phosphatase 27 (putative) Gene [Source:MGI Symbol;Acc:MGI:2685055]


SPLK-Sequence tag 3SE046A06
Sequence
AACCTCAAGTGTCATCCCTTAGGCTCCATGTACTTTGTTATTGAGAGAGGCTCCCTCACTGGCCTCAGGTTCAGTGATTA
GGCTGGGCTGGCTGCTGTGTGCACTCGAGGGAGCCTCCTGCTTCTGCCTGCCCAGTAGTGGAGCTATAAACACACGCACA
ATGCCTGGCTTTCTACACGGGTCCTAGGG
Sequence Type genomic DNA
Unitrap ID UNI9646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 168051551..168051739 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026564 (Dusp27) NM_001033344 dual specificity phosphatase 27 (putative) Gene [Source:MGI Symbol;Acc:MGI:2685055]

 
Come back to gene ENSMUSG00000026564


For any suggestions or comments, please send an email to unitrap@crg.es