Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB067A
Clone ID XB067A
Vector pGT0pfs
Project baygenomics

Sequence tag XB067A
Sequence
GCCGGAGGAAGAGCGGTTGCGACTCCTAAAGGGTACAGGTGTCCCCGAAGCCGTGGAGAAGGATTTGGTGAACATCCGTA
ACGAATACTATTCCATCGTCCTGCCCTTCATGGAGGCTCACTTGGATTTTTTCTATGCTTTTTTGATGTGAGGACCCGGC
TGCTCTGCAGCATGTGCGGCCCCCTGCCAAGCGCGCGCG
Sequence Type mRNA
Unitrap ID UNI10362

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 98240507..98240639 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031671 (Setd6) NM_001035123 SET domain containing 6 Gene [Source:MGI (curated);Acc:Setd6-001]

 
Come back to gene ENSMUSG00000031671


For any suggestions or comments, please send an email to unitrap@crg.es