Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E045G10
Clone ID E045G10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE045G10
Sequence
CTTCCTCGTCCCGAGCTCGATAGAGTCCGCTTATTTTCTTTAAGCTGGTTGTGGAGACATTCTGCGATTTCTTGATTCGG
GTGGAGGCTTTTGGCACTTGTAGAATAGGAGGGGAAGGGAGGGGAGACAAGAGGGTGTCGGAGCCGAGACCCCTCATTTA
TATCTCCAGACGCCGATTTAAGCACTTGGTTTCACTTCCTT
Sequence Type genomic DNA
Unitrap ID UNI22342

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61948865..61949065 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020078 (Vps26a) NM_133672 vacuolar protein sorting 26 homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:1353654]


SPLK-Sequence tag 3SE045G10
Sequence
CCTTCCCTAAGCGATTTCTATAACTTAGCCTGATGTATGGCGAGAAAGACGAGAATCGCGCAAAATGAGATATACACCCT
TTAGAACGTGAAATATGGCGAGGAAGACTGAAAAAGGTGGAAAATTTAGAAATGTCCACAGTAGGACGTGGAATATGGCA
AGAAAACTGAAAATCACCACTAGTGTCGACACCAGTCTCATTCAGCCACAAAANNNNTTNTTCNTNNNGTTNTTCNCGTT
TCCCTCTCTTTTCCTGNNTTGGTGGNTCTGTCTCGGCTCTCGCCTCTTTGTGGCTGGCTCCTCTTCCTTTCTGTGTATGG
GGCNTAGTTTCTCTGTCTATTCATCTGTTGNGCNTCTCGGCTGGCTCCNCTTCCTANGTATTGTGAGCNGTGTCGCTATC
TGCACTGAGATGCAAAAATCTTTGTGGTGTCTGACTTAGCCTTCTGGGTATATAATAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020078


For any suggestions or comments, please send an email to unitrap@crg.es