Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E045F03
Clone ID E045F03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE045F03
Sequence
GGTCCATGTCACTCACCTACAGTGACATTTCTCTCCGCTGTGCTTCTCCCCCACAGTGTAGCAGCTTCTTTGCTCGTACG
TAATTCGCAGGAGCAAGAAATGTTCTGTCTGCTTTTGAGGAAATACACCTTTAGATGGTTGGTGATCCTTCCCTCAGTGA
CTAAGCCTGAC
Sequence Type genomic DNA
Unitrap ID UNI29852

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20646445..20646615 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es