Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E044G11
Clone ID E044G11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE044G11
Sequence
TATATATTTCTTTTTACTGCTTTATGGGTGTTCTGCCTGGGTATATAT
Sequence Type genomic DNA
Unitrap ID UNI14400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74714169..74714216 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024067 (Dpy30) NM_024428 dpy-30 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1913560]

 
Come back to gene ENSMUSG00000024067


For any suggestions or comments, please send an email to unitrap@crg.es