Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E044E11
Clone ID E044E11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE044E11
Sequence
CAGCTCCGGGACCGGGAGGCTGCGAGGCCCGAGACGGGAAAGGAAGGAGGAGGGCAGGCGGCCAAAGTTAGGTCAGTTAG
TTGGTGGTCTTTTGAAATTGTGTTGGGTCCACGCAAACTGTCGCCTTGTGACTGCAGAGTCACACAGCCGACAAGTTCCA
ACTCTAGGAAG
Sequence Type genomic DNA
Unitrap ID UNI13985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17200911..17201081 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]


SPLK-Sequence tag 3SE044E11
Sequence
GAAGGCGTGGGGTCGTCTCCCTGCGTAGCTAGGTTCTCTTTTCTATCCACCTCTTAGTCATCCGCATCTCCTTTCCCTGA
TGAAGGGTGGGGGTTGGTTTCTGTCGTTGAAATCAAAACCTGCCAAAGTTTACGAAAATAACTTGGTATACGCACTTTGT
ATCTTGAATGTATGGGAGTGTCACTTCACTAATTGGCTCCTTTGGTGAAGCATACAATATAGGTGCTCAGTTGGAGTTTT
TCACGAGTAG
Sequence Type genomic DNA
Unitrap ID UNI13985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17200665..17200914 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]

 
Come back to gene ENSMUSG00000038965


For any suggestions or comments, please send an email to unitrap@crg.es