Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E044E05
Clone ID E044E05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE044E05
Sequence
TGTGTTTTGAATTTTGAATGTGTGTGGGGTTTTTGTTTTTGTATCCTTTGAGATAGTTCTGTAGTTTACAGAACTTTAAC
CCTTAACACAGCTCTGTTATCAGTAGATTGTAAGGGTCTTACCCTAATTTGTGTTCCTGTTTGCTTTTTCTTGTTTGTAC
TTTGGGATTATGAGTTGGTCATTCAGCAAGGTTTCGTCTGAGGAAGGCTTAAGACCTGTATGAGAGATACCTTGCATTTG
CTGTTAGGCAGC
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106671739..106671990 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]


SPLK-Sequence tag 3SE044E05
Sequence
TGCATCACTCACTGTGGGGCTACTGTAGTTTGCCTCTTGTTTTACGCAGTATAGGTATTTAAGTAAATACTTAAAACTCA
GATTAGTTGGAAGGCTGACTGGTTATTCCAGATTCCTGTTTGATAACCTTTTCCCTGTCTTTATGGTTAATTTTAGCCTT
CAGTTGAATAGATTAAGAGCTGCCTAGC
Sequence Type genomic DNA
Unitrap ID UNI7391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106671543..106671730 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040661 (Rad54l2) NM_030730 Rad54 like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1933196]

 
Come back to gene ENSMUSG00000040661


For any suggestions or comments, please send an email to unitrap@crg.es