Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E044D10
Clone ID E044D10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE044D10
Sequence
TGTAACTTATATTTAGCTGGGATGTAAGGTAACGGAAAATCAACTTGATAATGTGAATATGTATTATATAATCGTAAAAC
ATTTAAGATGAGTCTCAATTGCTTTAAAGTTGTAGAATCAGTTTTATTCTCTGTATTTATATTTAAAGACTCAAGCTTTA
ATAACAAGCTTTAATTATAAATACAGTCATATATAACAATTGATTAAATTATTTAATTATCATTTATGGAAATAAT
Sequence Type genomic DNA
Unitrap ID UNI27241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11626978..11627213 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031508 (Ankrd10) NM_133971 ankyrin repeat domain 10 Gene [Source:MGI Symbol;Acc:MGI:1921840]

 
Come back to gene ENSMUSG00000031508


For any suggestions or comments, please send an email to unitrap@crg.es