Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E044B03
Clone ID E044B03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE044B03
Sequence
CTGAAGAAGCATCCCCTTTTCCGTACCCGGAGCGCGCTAACTGCTGGGTCATTTGGCTTGTGGGGGAAGGCAGGGGGGAG
GAAAAGAACCACCGAGGTTTGGAGAGACTGCCTTTGGGGACTTGGAGAGAACCTACCGCAGTGCCTGAAGCAAAGGATTG
CAGCGTGGCTAGCAGTGCAGAGCGCCTTCGGTGTTAGGGA
Sequence Type genomic DNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65195517..65195716 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]


SPLK-Sequence tag 3SE044B03
Sequence
ACAGTGGTGTGGACCAGAACCTTTGGATAGCTTGGAGGTGGCAAATAAGAGTTGGAATTGTCATATCCATGTCTTTGGCG
GATAACAGAAACACTTCTGTAAATTTTTACTGCAGTACTTACAATAGTAGTATTTTACAATAATACTAATTGAATATGAA
TGAGCCTTTGAATAATTCAGGTTAAATGGACACTGGATAATGTTTACCTTGTATTCTTCAAAATAAACACTTTACACAGA
GTCATTGAGATTTTATTTTACACGGAGTCATGAGATTTGGTTCTAAGAACTTATATTTTTTTTCCTCTAATATTGTTGGA
GATACTTTATTCTCAAGAGTGGTGTTGGGGGGGAAGTATGAATTGGCATTCTGAATTCATTTGGATTTGATATCTTGTCA
CTAAGCAAAATTGAGTGAACGTGGGCCAGTTAAGATAAATGAGAACTTTATGCATAAATTTGAGGAACACTTTTTATAAG
AAATTCTGCTTGCATGATAACTTGCCTCATCCCAGGAATGTAACAAACATCTTAATAATTTTGTAAGTTAGGGTTTATGA
AGAAAGAGCCCCCTGAGTTATTCCGTGGCTTAAACGTGCGTGTTTACCTTAGGCTGTTTAGAGAAACCTGAAAGAAGATG
TTTGATTAATTTATACTCCCTAGAGAAAAATCAGTTTTCTCATCATTGAGGTTTGCTGCAGACCGTCGCCGCTAGCCAAG
TCCTGTGGAGGTGCTCTGTAGTGACCATTTGGCTGAAATTAAGGAGAGTATCAAAGTGTAGGAGTGACAGT
Sequence Type genomic DNA
Unitrap ID UNI770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65195742..65196532 789
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029178 (Klf3) NM_008453 Kruppel-like factor 3 (basic) Gene [Source:MGI Symbol;Acc:MGI:1342773]

 
Come back to gene ENSMUSG00000029178


For any suggestions or comments, please send an email to unitrap@crg.es