Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0135
Clone ID AY0135
Vector pGT0lxr
Project sanger

Sequence tag AY0135
Sequence
ACCCACGTTAGAGAGCACCCGGATGTCTTACACGGAGCTTGGACTCGAGGGAGCCCCGATCCAGAAGACGTGTAGCAATG
GCTGCTGTTTATTATGGTATTTCCTTTGAAGTTAAAAGCAAGACAACTTCCTGGGAAGATAAACTAAAATTAGCTCACTT
TGCTTGGATTTCCCATCAGTGCTTTCTACCAAATAAAGAACAA
Sequence Type mRNA
Unitrap ID UNI1170

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126545644..126547498 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031976 (AK122209) NM_001029876 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2681124]

 
Come back to gene ENSMUSG00000031976


For any suggestions or comments, please send an email to unitrap@crg.es