Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E042E08
Clone ID E042E08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE042E08
Sequence
GATCTAGGGCTGTCTGGATATCAGAGCTTAAAGTTTGGGTGGGCTTGGGCGGGAATTCATTCAGGGCCATCAACGTCTAT
AGCCGTATGGAGAAAAATGAAAGACTTGCTAATCACATTAAAGAAGTGTGTGGGATGGAAGACCCAGGGGAAAGTCTTCC
AGATGAGATCCTGAGATGGTTGGCAACAGGTGACAGACAACAAGCCAGCCCCCGGCAGGAACCAGTGACATACAGAAGCA
AAGCTATGACAAAGCTGAGAAGAGT
Sequence Type genomic DNA
Unitrap ID UNI7564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58090946..58091210 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]


SPLK-Sequence tag 3SE042E08
Sequence
TTGGTCGCTGTTGAAGGGAGCCATNNCTGATGGACTGCATAGGGACTATAGTGCGGTAAGCAGGTGCCAGAGGTATGCCA
GAGGTACGAACTTGAAGGAGACTCCCTTCCTTGCCTGGCCTGAATTAACCCTCTGGGAGAATCTACCCCAGCTTTGTACC
CTGGGTACCTAGCAGCCACTTCCTTCCAGCCCTGCCTGTCCCCACCCTATGTCCCCACCCACTCACACCCTGTGCAATTT
TTAGTGCGTTGCAGCTCAGTGGTGTTACTAAGTTTGGTTTCAGGCAACATAACAGAAAAGATAGGAAAATGATTCCTTTC
TCGGGTTTTATATGCAGTTACCCAGGAGACTTGTTTCAGACCCAGTAATAACCATGGTCCATTTGGTAGGATGCGATGTG
TATAAGAGAG
Sequence Type genomic DNA
Unitrap ID UNI7564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58090537..58090946 389
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es