Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E042B06
Clone ID E042B06
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE042B06
Sequence
GATCCTGTGTTCTAAATTCCTATGCTACTTTGCCACTAGTAAACTAGAGTTCTGTAAAGTTCAAAAATGATGTCTGGAAT
ATAGTAGGCCCTCCAGTTTTTAATCATTTTAGTGGATACCATGAACTACGTACTAAAGAAAATCTAAATACAATGAGAAG
TAGTTCTTGTTTGCAGAAGCTTCCTGTCTAGTTTGAATGACCAAAACATTCTTAATCAGAAAATTAACAAAGTAAAGAAA
ATTGAAATGTAACTCGGTTGCCCATACTTTATAGATTTCTATCAAGCACAAAGGTTAAAATGACTTAGAAGTGGTAGATA
ATACGGTCAGCACCTGTCTCATTCAGCCACAGACTGTTTTGGGTTGTATGTAGTTGTGGGATATGACTGACTGGAAAGGA
AGGAAAACTTGGTCGATAACTTCTAAATACAAAGATGGTGGTGGAAGAGGACAGTTTTTGGAGAATGACTAGAATAGGTG
ATTTTAGGTGATAGACTGAAATGAAGCTATAAAGATAATTATAATCATTGCGAACCTTTGTCGAGGATAT
Sequence Type genomic DNA
Unitrap ID UNI29864

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11707366..11707915 536
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035455 (Fignl1) NM_021891 fidgetin-like 1 Gene [Source:MGI (curated);Acc:Fignl1-001]

 
Come back to gene ENSMUSG00000035455


For any suggestions or comments, please send an email to unitrap@crg.es