Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E042A07
Clone ID E042A07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE042A07
Sequence
TACATCTCTGCTGGCCACGGCCTTCCTCAGGGTCCAGATGGGAGAGCTGGGGAGCTGTTTTCCTCCACAGTGTAAGACCT
AGCGTGACAAACGACTCCGATAACCACATTGTGACCCTCCTAATGAAATATTTTCTTTCTCAGTGATGTTACAGCCTTTC
GATTATG
Sequence Type genomic DNA
Unitrap ID UNI241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 173596879..173597045 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054455 (Vapb) NM_019806 vesicle-associated membrane protein, associated protein B and C Gene [Source:MGI (curated);Acc:Vapb-001]

 
Come back to gene ENSMUSG00000054455


For any suggestions or comments, please send an email to unitrap@crg.es