Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E042A04
Clone ID E042A04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE042A04
Sequence
GATCTAATTGTTACCTTGCTTAGGGGAAGGGGACTCTTCGGGGAAGAAAGTAAAAGATTGTATCTTTGAGACTCATATGC
GGGTTCCCTAGGCTGCTCTGAGAATACACCAGCTGCTTGAAAAGCTCTTCTGTGGAATCTACACATAGGAAACTCGAGTA
GGGAAGGGGCTGGGTCCTTCTGGTCTGATGTAATTGGGCGGCTCAGGCAGGCCAAGGAGACCTGAGCANNGGCGAAGTTC
CGACTCAACAAGTTAGGTCGAGGTTTTAGATAGCTATGATTAGCAGCGAGCATTTCCTCACATATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SE042A04
Sequence
ATATGCCCTCCACTTTTTTAAATAGAATTTTTATCATTACTCATGGGAGTTTGTGTTTTCTTTTGGAATTAAAGTTATTT
ATATTTAAAAGCATTAAAGTCCTCCCTCCCCACCTGTCTTGATTTTAGCAGCCGAAGGGATTAATCCAGCTGTTAGACTA
AAAAGGAGGTGGGACCCTGAGCTGGGAACTGGATGGTGTAGAGAAGGAATGGTTTCTGGGG
Sequence Type genomic DNA
Unitrap ID UNI5812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127474496..127474716 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061315 (Naca) NM_013608 nascent polypeptide-associated complex alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:106095]

 
Come back to gene ENSMUSG00000061315


For any suggestions or comments, please send an email to unitrap@crg.es