Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E041H03
Clone ID E041H03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE041H03
Sequence
GGGATCTCAGGCCACAGTTCTCTTCCACTTGGAAGACTAGTCAGAGGACTGGCCCGGGTAGAGACAGCCACATGGTCTGT
GCGTACGTAAATTAATGCAGCCATTGGTGATGAAAAGCGGGGAGTCTTTGTAGTTTGGGAGTGAACAGGAAGTTGTGCCT
TGTCAGGAAGAAAAGAATTCTATGGACCTATCATAGGTCCATATGTTCAAAGCATCAGTTACAGCTTTCCAAGCAAAGTG
TTTGTATGTTGGCTACCAC
Sequence Type genomic DNA
Unitrap ID UNI16579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20128679..20128937 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]


SPLK-Sequence tag 3SE041H03
Sequence
TTCTTCAGTAAGTATGCATAAAATACAGTATTTTTACATGCCTGATGCTACACAGCATGATTTACCATAATGCTTATGGG
CATGATCCAAATAAAGAGTTTTGTTGTTACTGGTTTGTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20128367..20128486 116
NO GENE  

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es