Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E041G02
Clone ID E041G02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE041G02
Sequence
GACCCACTCCTGACACTATAGACTATTGAAATGAAACCATAGACAAAATGGGTTGAGTAGATTTTGATCAAAGAGGTGAT
TATGAATGGGCAACATTCTGAATCAGTAGAGTTCAGAGAGCGCCACCTGGCAACTTTGTAAGTGGTTACACAGAGACAGC
TTAATTGGTTAAATCTCAATGACAGCATGTCTGTTTGGAATATGGCGTGTTGTAATGCCACTTTGAAATTTGGTACATCT
CTTCAGTTTATCATGGTTTTTGTTGTTATACCTGATTCTAGGTTACATGCTGGATGGGATGTGATCACTTGGTTTCTGAC
AGTAGCTGCAAGCAGCCAGGCATGTTCATTTGCTTCTTTGAAAAAAGAAGGTGGAATATACTGGATACTAAGTGTCCAAC
ATGAATTTCTCTGAAGAGCCAGCCTCAGGCTAGGATATAAGGGCAGAACTGATGTCACTTCAATAAGTTTTATCTCAGAA
TGTAGTCC
Sequence Type genomic DNA
Unitrap ID UNI29866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181264623..181265110 488
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000826 (Dnajc5) NM_016775 DnaJ (Hsp40) homolog, subfamily C, member 5 Gene [Source:MGI (curated);Acc:Dnajc5-001]


SPLK-Sequence tag 3SE041G02
Sequence
CATTAAAACACTGTGTCATCTATGGATATTTTATGAATTCTTGTACCCTCTTGCTTTTCTCTACTGAAATTGTGTCTTAA
CCTTTCTTTTATATTTAATGTGGCGTTTCCAACATCCCAAAATGAATAAGATAAAGAAAGGCAGCATGTACACTGCTCTG
AACATGTATCTCAGAATTTTTAAATAGATGTTGTAGTCTTATACTGTCCTAATAGAATTTTTGGTTTGTTATGTTGT
Sequence Type genomic DNA
Unitrap ID UNI29866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181265110..181265345 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000826 (Dnajc5) NM_016775 DnaJ (Hsp40) homolog, subfamily C, member 5 Gene [Source:MGI (curated);Acc:Dnajc5-001]

 
Come back to gene ENSMUSG00000000826


For any suggestions or comments, please send an email to unitrap@crg.es