Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E041E08
Clone ID E041E08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE041E08
Sequence
GATCTTAAGTTTGTTTTAATAACATTTGTTTTAGTAACAATCTTTGAAATGCATGGACCATATCACTGCTTTTGCCTTTC
CTTGTGTGTGAGGAGCTATAATAATTCCCAACGTGGAGCCACAGTCCCCATCCTCCTGGATTCCAATTCCTACTTACTTT
TTATTGTTTGCTTTTCATTTTGAGAGGATTTCTTTGTGTAGTTTGGGCT
Sequence Type genomic DNA
Unitrap ID UNI29669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43205389..43205597 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038214 (AK122525) NM_199028 BEN domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2677212]


SPLK-Sequence tag 3SE041E08
Sequence
ACTTGTCCAGCTGTGTTCCACTCTTGAGGCTCACATGCTCCAGGTAATCTGTGTGGTAGTGAGCACATAGCGTTACATCT
GGAAACAGACCCTGAAGTGAGGAGGGTTTGTCTCTGAATGGTGAGGTCAGGCAAGTGTGGGTCAGCCTGTTGGCAGACTT
CAAGGCGGTTTCTAATTTAACGGGGCAGAATGCAGAGTCATTTGGCTGGGATCGAACCTTAAGTTTCAGAAAGCCCTCAA
GTACTTCCTGTTTCTGGGTCTGCTGCTTGTCCTGGGTACTGTACATCTCTGAGTAGCTGCCCCTCCACTCGGGGTCTCAT
CCTTTCTGGAAAAGTCTTTTCAGAGAACTCAAAAAGTATGGGTACTGAGCCGCTCTAGCCCGTGCTGGCAACACTGAAAA
ACTATTCTTCTGGAACCTAGGGACCAAATGGTCCTGCAGTCCTGTGAGGGCTGGCCAGAGGACTTGCCACATGAGCTGTC
CCTTCTTGTCATCACCTTCCACCTTGTTTAAGGACTGGTTCCCCAGTCAGATCCCA
Sequence Type genomic DNA
Unitrap ID UNI29669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 43205681..43206216 522
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038214 (AK122525) NM_199028 BEN domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2677212]

 
Come back to gene ENSMUSG00000038214


For any suggestions or comments, please send an email to unitrap@crg.es