Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E041B01
Clone ID E041B01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE041B01
Sequence
GATCTGTACAGAACAGGATATTTTCTGTGTCCTTCCCTGCTCTGCTCATGCCTACCACAGGAATAGGACTTCCTAATAAT
TTGCTGAAAGAATTAAAGAATAAGCCAGACCTGAAATAAACCAGTACCTCCAGTACCTCCAATAAATGAAATAGAAGAGG
TAAGATGATTTGTAATAATGTTTTTATTTTAACCCATATATTGAAAA
Sequence Type genomic DNA
Unitrap ID UNI29869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20312415..20312621 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060510 (5730601F06Rik) NP_001128491 RIKEN cDNA 5730601F06 gene Gene [Source:MGI Symbol;Acc:MGI:1924769]


SPLK-Sequence tag 3SE041B01
Sequence
ACCATTCTAGTACATAATAAAACATTTGGATGCTTACTTTTTTCCAGACATGTTTGATTTATGTTTATAATAAATGAGAT
GAGTAGTTTTTAAAGATTGAGAACCTGGGGTGTAGGTTAGTGGTAGAGTGTATGTTTAGCTTGAGG
Sequence Type genomic DNA
Unitrap ID UNI29869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20312268..20312413 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060510 (5730601F06Rik) NP_001128491 RIKEN cDNA 5730601F06 gene Gene [Source:MGI Symbol;Acc:MGI:1924769]

 
Come back to gene ENSMUSG00000060510


For any suggestions or comments, please send an email to unitrap@crg.es