Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XB276
Clone ID XB276
Vector pGT0pfs
Project baygenomics

Sequence tag XB276
Sequence
CAAGCCATGTTTGCCAAAGGCAAAGGCTCGGCGGTGCCCTCGGACGGGCAGGCTCGGGAAAAGTTAGCTTTATACGTCTA
CGAATATTTACTGCACGTAGGAGCACAGAAATCTGCACAGACCTTCTTATCAGAGATTCGATGGGAAAAAAACATCACAC
TGGGTGAACCGCCTGGGTTCCTGCACTCGTAGGTGGTGTGTATTTTGGGACCTTTACTGTGCAGCTCCTGAAAGGAGAGA
CACTTGTGAACATTCAAGTGAAGCAAAAGCCTTTCATGATTATAGTGCAGCAGCTGCCCCAAGCCCTGTGCTTGGCAACA
TTCCCCCCAATGATGGGATGCCCGGAGGCCCCATCCCGNCCAGGTTTCTTT
Sequence Type mRNA
Unitrap ID UNI4218

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106584456..106682370 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061887 (Ssbp3) NM_198438 single-stranded DNA binding protein 3 Gene [Source:MGI (curated);Acc:Ssbp3-001]

 
Come back to gene ENSMUSG00000061887


For any suggestions or comments, please send an email to unitrap@crg.es