Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E039F03
Clone ID E039F03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE039F03
Sequence
CCTTCCCTTTGGCTATAAAGGACACAGTTCAGACACAGGTAAACACAGAGGT
Sequence Type genomic DNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88375553..88375604 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]

 
Come back to gene ENSMUSG00000005370


For any suggestions or comments, please send an email to unitrap@crg.es