Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E039D04
Clone ID E039D04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE039D04
Sequence
GATCCCTTTAGAAGTTAAGAAGGTGAACTACATTCTAAACATTTGCTGCACGAGTC
Sequence Type genomic DNA
Unitrap ID UNI15182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43574577..43574632 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]


SPLK-Sequence tag 3SE039D04
Sequence
GAGTCAAGTCTGTTTCGCATANNNNAACATTTAAACTGAGGTCATTATTTTCTGCGATGACCAGCATTAAGTCAGAGTAC
AGGATCGGGTTAAGGATCAACAGGAATTGGCTTAGATGCCCGTTTTAGGGATTAAAGGCCGGTGTCATGGTCAGTATTAA
GAATAAACAGTGAAAAGGTTAATTAAGAACCAAGTTACAAATGAGCTTTAGAACTGCAGGGTGGGGTGGGAGGGAGTATT
TAGGGTTAAATTTGGGGGATTTGGGCCTAAAAATAAAAGCCAGATTAGTATGGGTGTCTTCTGGGAAAGGGGTGAATGTC
AATGTATAGGGAAATAGGAAATAAAGTCAGCATTAATGTTAGGAATTGGTGATAGCGTTAGGGGTTGAGGCTGCAGCTAC
AGCTGAGCTGGTAAAATGTAAGAAGTTGGCAGGAAGTAGCTACCTTTGTTTTGTAGTGAGTTCTCTTATTCCTGTGCAGT
TACAGAGGCCTCTTTTACCCAAAGAAGTGCTAGAGCTCTGGACCTCAGCTAGAAGTGCCAGGACTCTGCTTTCTCTAGTC
TACTGCCTAAGCACAAGGCTTCCCAGAGGCCACACCACTGGGAGACAGGGATTTCTGGGCTGT
Sequence Type genomic DNA
Unitrap ID UNI15182

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 43573960..43574581 602
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028465 (Tln1) NM_011602 talin 1 Gene [Source:MGI (curated);Acc:Tln1-001]

 
Come back to gene ENSMUSG00000028465


For any suggestions or comments, please send an email to unitrap@crg.es