Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E038E04
Clone ID E038E04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE038E04
Sequence
CTATTTTTCAGTCATTTCNNNCTTACTCGCTGACACATTTATCTTAGAGGAACCGAGAAGCCCTGAGCCTCAGCTCCCCA
TACCACTTGTTTCCAGGGTTTCTGGGTGAAGATTTTTGTGATCTGTTCATTATTATTGTTATTATCATCCTTATATTTAA
ATAA
Sequence Type genomic DNA
Unitrap ID UNI11185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88811088..88811251 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000278 (Scpep1) NM_029023 serine carboxypeptidase 1 Gene [Source:MGI (curated);Acc:Scpep1-001]

 
Come back to gene ENSMUSG00000000278


For any suggestions or comments, please send an email to unitrap@crg.es