Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ex153
Clone ID Ex153
Vector pGT1.8TM
Project baygenomics

Sequence tag Ex153
Sequence
TGCCAGCACATGAGTACAGGATCAATAAGCCAAGAGCTGAGGATTCAGGCGAATACCACTGTGTATATCATTTTGTCAGC
GCTCCTAAAGCAAATGCCACCATTGAAGTGAAAG
Sequence Type mRNA
Unitrap ID UNI10245

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58475638..58475735 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032336 (Nptn) NM_009145 neuroplastin Gene [Source:MGI Symbol;Acc:MGI:108077]

 
Come back to gene ENSMUSG00000032336


For any suggestions or comments, please send an email to unitrap@crg.es