Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone E038C01
Clone ID E038C01
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE038C01
Sequence
CATGANNAATGAATAAAATTTAAACCCAGTAAGTACGCTTGGAATTCCATTTTCCTGAACTGAGTTACTTGGTTCCTTTT
TTTAAACTAAATTTAATCTTTAAAAAGGACCTACTCAC
Sequence Type genomic DNA
Unitrap ID UNI29879

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72559105..72559222 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es