Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone Ex158
Clone ID Ex158
Vector pGT1.8TM
Project baygenomics

Sequence tag Ex158
Sequence
CCATCCAGGTCAGGAGACTGAAATCTCACCCCTCCATCATCATATGGAGTGGTAATAATGAGAATGAAGTGGCTCTCAGC
GTGAACTGGTTCCACGTAAATCCCAGGGACATGGAAACGTACATTGACGACTACGTGACCCTCTATGTGAAGAACATCAG
GAAGATTGTCTTATCAG
Sequence Type mRNA
Unitrap ID UNI9669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135212161..135212332 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es